 |
Borrelia burgdorferi Organism specific information
Introduction
Lyme borreliosis (LB) is the most frequent vector-borne disease
in humans in the temperate zone of the Northern Hemisphere.
Clinical symptoms include arthritis, skin manifestations,
such as acrodermatis chronica atrophicans (ACA) or erythema
migrans (EM), and neurological disorders, such as facial
palsy. The zoonotic disease is caused by several species
belonging to the LB group of spirochaetes within the genus
Borrelia. LB group spirochaetes have complex life cycles
that involve ixodid (hard) ticks as vectors and a large
number of vertebrate species as reservoir hosts, in particular
small mammals and several bird species. Relapsing fever
(RF) spirochaetes constitute another major group within
the genus Borrelia. Except for B.
recurrentis, which is
transmitted by body lice, RF spirochaetes are transmitted
by argasid (soft) ticks. Relapsing fevers are occurring
mainly in subtropical and tropical regions.
A novel MLST scheme has recently been developed for B.
burgdorferi by Gabriele Margos and Klaus Kurtenbach (University of Bath,
United Kingdom), in collaboration with researchers from the
U.S. (Yale University, NYMC, Centers for Disease Control,
University of Utah), U.K. (University of Oxford, Imperial
College London, University of Bath) and France (Institut
Pasteur). Unlike a previous MLSA scheme of LB group spirochaetes,
this MLST scheme is based exclusively on chromosomal housekeeping
genes. Due to primer design, this MLST scheme is currently
being extended to MLSA comprising other species within the
genus Borrelia. The MLSA scheme has the power to characterize
the spirochaetes at all the different phylogenetic levels
required for evolutionary, epidemiological and fine-scale
population/landscape genetic studies. Importantly, this scheme
can be applied to infected ticks without the need to culture
the spirochaetes, which can be fastidious and selective.
This feature renders the MLSA scheme a highly useful tool
in large-scale epidemiological studies of these vector-borne
bacteria.
The development and validation of the scheme is
funded mainly by The Wellcome Trust, London, U.K. (to K.
Kurtenbach) and the NIH, U.S.A. (to D. Fish, Yale University,
K. Kurtenbach, and I. Schwartz, NYMC). David M. Aanensen
is funded through a Wellcome Trust grant to Brian Spratt,
Imperial College London, U.K.
Margos, G., A.G. Gatewood, D.M. Aanensen,
K. Hanincová,
D. Terekhova, S.A. Vollmer, M. Cornet, J. Piesman,
M. Donaghy, A. Bormane, M.A. Hurn, E.J. Feil, D. Fish,
S. Casjens, G.P. Wormser, I. Schwartz, and K. Kurtenbach.
2008. MLST of housekeeping genes captures geographic population
structure and suggests a European origin of Borrelia
burgdorferi. Proc. Natl. Acad. Sci. USA., published
online 24/06/08
Housekeeping genes and PCR primers
gene
(number*) |
Primer 5' to 3' |
Primer name |
Product Length |
nifS (BB0084) |
seminested |
|
|
Inner forward |
same as outer
forward |
|
|
Inner reverse |
TCACAGCCAATTTTTTTAAC |
nifR680 |
629 |
Outer forward |
ATGGATTTCAAACAAATAAAAAG |
nifF1 |
|
Outer reverse |
GTTGGAGCAAGCATTTTATG |
nifR719 |
|
|
|
|
|
clpA (BB0369) |
|
|
|
Inner forward |
GACAAAGCTTTTGATATTTTAG |
clpAF1255 |
|
Inner reverse |
CAAAAAAAACATCAAATTTTCTATCTC |
clpAR2104 |
706 |
Outer forward |
GATAGATTTCTTCCAGACAAAG |
clpAF1240 |
|
Outer reverse |
TTCATCTATTAAAAGCTTTCCC |
clpAR2214 |
|
|
|
|
|
rplB (BB0481) |
seminested |
|
|
Inner forward |
CGCTATAAGACGACTTTATC |
rplF40 |
|
Inner reverse |
same as outer
reverse |
|
|
Outer forward |
TGGGTATTAAGACTTATAAGC |
rplF2 |
|
Outer reverse |
GCTGTCCCCAAGGAGACA |
rplR760 |
720 |
|
|
|
|
pyrG (BB0575) |
|
|
|
Inner forward |
GATATGGAAAATATTTTATTTATTG |
pyrF448 |
|
Inner reverse |
AAACCAAGACAAATTCCAAG |
pyrR1154 |
687 |
Outer forward |
GATTGCAAGTTCTGAGAATA |
pyrF391 |
|
Outer reverse |
CAAACATTACGAGCAAATTC |
pyrR1190 |
|
|
|
|
|
recG (BB0581) |
|
|
|
Inner forward |
CTTTAATTGAAGCTGGATATC |
recF917 |
|
Inner reverse |
CAAGTTGCATTTGGACAATC |
recR1658 |
741 |
Outer forward |
CCCTTGTTGCCTTGCTTTC |
recF890 |
|
Outer reverse |
GAAAGTCCAAAACGCTCAG |
recR1694 |
|
|
|
|
|
clpX (BB0612) |
|
|
|
Inner forward |
AATGTGCCATTTGCAATAGC |
clpXF403 |
|
Inner reverse |
TTAAGAAGACCCTCTAAAATAG |
clpXR1124 |
721 |
Outer forward |
GCTGCAGAGATGAATGTGCC |
clpXF391 |
|
Outer reverse |
GATTGATTTCATATAACTCTTTTG |
clpXR1273 |
|
|
|
|
|
pepX (BB0627) |
|
|
|
Inner forward |
TTATTCCAAACCTTGCAATCC |
pepXF449 |
|
Inner reverse |
TGTGCCTGAAGGAACATTTG |
pepXR1115 |
666 |
Outer forward |
ACAGAGACTTAAGCTTAGCAG |
pepXF362 |
|
Outer reverse |
GTTCCAATGTCAATAGTTTC |
pepXR1172 |
|
|
|
|
|
uvrA (BB0837) |
|
|
|
Inner forward |
GCTTAAATTTTTAATTGATGTTGG |
uvrF1434 |
|
Inner reverse |
CCTATTGGTTTTTGATTTATTTG |
uvrR2111 |
677 |
Outer forward |
GAAATTTTAAAGGAAATTAAAAGTAG |
uvrF1408 |
|
Outer reverse |
CAAGGAACAAAAACATCTGG |
uvrR2318 |
|
PCR conditions for MLST housekeeping genes.
HotstarTaq Mastermix (Qiagen, Germany), 25 pmol of each primer,
forward and reverse, and 2.5 ml of template DNA (purified
DNA of isolates or tick lysates) were used for the first
set of amplification cycles (25 ml final reaction volume).
For PCR on tick-derived material, the MgCl2 concentration
was adjusted to 2.5 mM. Bioline Immomix Red, 50 pmol of each
primer and 5 ml of product derived from the primary set of
cycles were used for the second set of amplification cycles
(50 ml final reaction volume).
The PCR conditions for the housekeeping genes, except for recG, were
as follows: for the first set of cycles, touchdown PCR was
used with annealing temperatures starting from 55 oC and
decreasing 1 oC each cycle. Specific conditions were 95 oC
for 15 min, 94 oC for 30 sec, annealing temperature from
55 oC to 48 oC for 30 sec, and an extension step of 72 oC
for 30 sec. An additional 20 cycles were run at 94 oC for
30 sec, annealing temperature of 48 oC, and extension at
72 oC for 30 sec. After a final extension step for 5 min
at 72 oC, the samples were kept at 15 oC until further analysis.
The conditions for the second set of 35 cycles were 95 oC
for 7 min, 94 oC for 30 sec, 50 oC for 30 sec, 72 oC for
30 sec. After a final extension step for 5 min at 72 oC,
the samples were kept at 15 oC.
For recG, the PCR conditons for the first set of
cycles were 95 oC for 15 min, 94 oC for 30 sec, 55 oC for
30 sec, 72 oC for 30 sec, 30 cycles, and extension at 72
oC for 5 min. The conditions for the second set of cycles
were identical, except for an initial denaturing step at
95 oC for seven minutes.
|
 |